Serum samples were diluted 1:20 in PBST and added to the antigen-coated wells, after incubation and washing, HRP conjugated anti-human IgM antibody (Dako, Denmark) was added. the developing fetus. Acute infection in untreated pregnant women may cause fetal transmission and congenital toxoplasmosis with complication outcomes in fetus (7). Diagnosis is critical in pregnancy and it is based on serological tests with detection of specific IgG and IgM antibodies. The prevalence of infection in human populations is different from 4% to 92% in Korea and Brazil, respectively (8, 9). Some epidemiological studies have been conducted in Iran, for example in a recent systematic review the prevalence ranges from 18% to 70% has been reported (10). Despite the large number of studies for detection of infection in sera from Iran, there is no comprehensive and documented survey on cord blood samples in this country. To estimate the rate of congenital toxoplasmosis, this study was performed for detection of anti-IgG and IgM Macitentan (n-butyl analogue) antibodies in cord blood serum samples and PCR for IgM positive blood samples in Tehran, Iran. Materials and Methods Sampling This cross-sectional study was performed on 1000 cord blood samples collected during 2015 from Shahid Mostafa Khomeini Hospital in Tehran, Iran. Sera were collected and kept frozen at ?20 C until use. In order to perform complementary PCR test, 1000 whole cord blood samples were collected from these cases and kept frozen too. The age of mother and gestational age was recorded in relevant questionnaires. This study was approved by Ethical Macitentan (n-butyl analogue) Committee of Tehran University of Medical Sciences, Tehran, Iran. Antigen preparation Antigen preparation was performed (11). Briefly, tachyzoites of IgM Macitentan (n-butyl analogue) antibody. Detection of IgM antibody was performed by IgM-ELISA method. Briefly, antigen-coated microtiter plate was prepared as described. Serum samples were diluted 1:20 in PBST and added to the antigen-coated wells, after incubation and washing, HRP conjugated anti-human IgM antibody Macitentan (n-butyl analogue) (Dako, Denmark) was added. Afterward, incubation and washing, the substrate OPD (Merk, Germany) was added, and the OD of each well was recorded by an ELISA-reader (BIOTEC, LX800, USA) at 492 nm. The optimal amount of antigen and dilution of serum and conjugated anti – IgG and IgM antibodies were obtained by checkerboard method for each IgG and IgM antibody tests. In each procedure, 50 random cord blood sera were tested by ELISA method and the cutoff was determined as the mean plus two times of the standard deviation of the absorbance readings acquired for random samples (X2SD). The optical densities more and less than cutoff SAPKK3 were considered as positive and negative. PCR Method PCR was performed for samples with positive result in IgM ELISA. According to the PCR was performed for one sample with borderline IgM antibody (14). According to manufacturers instructions, the DNA was extracted from serum samples by PCR kit (QIA Gene amp DNA mini kit, Germany). The amplification of B1 gene was carried out with two sets of primers: B1ToxoF 5GGAACTGCATCCGTTCATGAG3 B1ToxoR 5TCTTTAAAGCGTTCGTGGTC3. For amplification, 25l of master mix (Ampliqon, Denmark), 4 l of extracted DNA, 2l of primer F and R, and 17 l of distilled water were mixed by shaker. Then were centrifuged at 1000 g for 20 seconds. The reaction was carried out in a thermocycler (PeQlab, England). After an initial denaturation at 95 C for 10 min, 40 cycles were run, including denaturation (92 C for 30 sec), annealing (55 C for 50 sec), and extension (72 C for 30 sec) and final extension at 72 C for 7 min. PCR products and DNA ladder (Solis-Biodyne, Estonia) Macitentan (n-butyl analogue) were electrophoresed in 1.5% agarose gel (Merck, Germany) and stained with ethidium.
Categories